Mutacja wzmocnienia funkcji w genie HIF2A w rodzinnej erytrocytozie cd

W wieku 63 lat miała zawał mięśnia sercowego, rok przed ostatnim testem. 89-letnia babcia ze strony matki, w wieku 54 lat, wykazała podwyższone wartości hemoglobiny, hematokrytu i masy czerwonych krwinek (odpowiednio 19,1 g na decylitr, 54% i 35 ml na kilogram) oraz prawidłową białokomórkę i liczba płytek krwi. Jej szpik kostny był normokomórkowy. Cięcie przeprowadzono dwa do trzech razy na rok, aby utrzymać hematokryt poniżej 50%. Jej historia medyczna była znamienna tylko dla nadciśnienia i zapalenia uchyłków. Od końca 81 roku życia nie potrzebna jest przecinek, ponieważ poziom hemoglobiny wynosi od 14,0 do 15,5 g na decylitr, a hematokryt wynosi od 45% do 52%. Ona pozostaje dobrze. Najnowsze badania (w grudniu 2006 r.) Wykazały poziom hemoglobiny na poziomie 14,3 g na decylitr, hematokryt 46%, liczbę białych krwinek 6700 na milimetr sześcienny, liczbę płytek krwi 186,000 na milimetr sześcienny i poziom erytropoetyny w surowicy. 118,6 mU na mililitr.
Metody
Pacjenci
Pacjentka wskaźnikowa pochodziła z grupy 181 pacjentów z erytrocytozą, którzy zostali skierowani ze szpitali w Zjednoczonym Królestwie i Irlandii.10 Wszyscy pacjenci mieli podwyższony hematokryt, a poziom erytropoetyny był szeroki. Pacjenci nie spełniali kryteriów diagnostycznych dla czerwienicy prawdziwej ustalonej przez Brytyjski Komitet ds. Standardów w Haematologii.18 Wszyscy pacjenci wyrazili pisemną zgodę na przystąpienie do badania, które zostało zatwierdzone przez komisję etyki badawczej Queen s University w Belfaście i zostało przeprowadzone zgodnie z Deklaracją Helsińską. Po wprowadzeniu do rejestru pacjenci są rutynowo poddawani badaniom przesiewowym pod kątem wad receptora erytropoetyny, 19 genu VHL, 9,10,20 i genu PHD2.7
Mutacyjna analiza HIF2A
Egzon 12 genu HIF2A amplifikowano z DNA z jednojądrzastych komórek krwi obwodowej za pomocą testu reakcji łańcuchowej polimerazy (PCR) z przednim starterem 5 TTGAGCAGCACTGTGAAACA 3, starterem do tyłu 5 ACATGGCTTGAGGTGATTCC 3 i temperatura wyżarzania 55 ° C. Oczyszczony produkt PCR 773-bp sekwencjonowano za pomocą zestawu BigDye Terminator (Applied Biosystems). W celu identyfikacji mutacji G1609 . T, zaprojektowano startery odporne na amplifikację (ARMS) -PCR z zastosowaniem programu do projektowania starterów opracowanego przez Ye i wsp.21 (http: //cedar.genetics.soton. ac.uk/public_html/primer1.html) (sekwencje dostępne na życzenie). Próbki DNA z jednojądrzastych komórek krwi obwodowej członków najbliższej rodziny pacjenta i 200 normalnych próbek kontrolnych pochodzących od niespokrewnionych, zgodnych etnicznie dawców krwi z Wielkiej Brytanii (panele DNA ludzkiej kontroli losowej, europejskie kolekcje kultur komórkowych) również poddano badaniom pod kątem G1609 . mutacja T, za pomocą ARMS-PCR.
Plazmidy, białka, peptydy i linie komórkowe
Sekwencję kodującą ludzki HIF-2., otrzymany ze zintegrowanej analizy molekularnej genomów i ich ekspresji (IMAGE), klonu konsorcjum 6305604 (American Type Culture Collection), subklonowano do plazmidu pcDNA5 / FRT / TO, razem z N-końcowym 3xFlag etykietka
[więcej w: aminotransferaza asparaginianowa, baspol, kaspol ]